If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Clinic for Thoracic and Cardiovascular Surgery, Herz- und Diabeteszentrum NRW, Ruhr-Universität Bochum, Bad Oeynhausen, GermanyHeart Failure Department, Herz- und Diabeteszentrum NRW, Ruhr-Universität Bochum, Bad Oeynhausen, Germany
Department of Internal Medicine I, Division of Endocrinology, Diabetes and Metabolism of the Johann Wolfgang Goethe-University, Frankfurt am Main, Germany
Department of Internal Medicine I, Division of Endocrinology, Diabetes and Metabolism of the Johann Wolfgang Goethe-University, Frankfurt am Main, Germany
Low vitamin D levels have been associated with various diseases, including cardiovascular disease, although data are not consistent. Serum vitamin D levels depend on different synthesis steps which are controlled by gene cascade. This study investigated whether low serum levels of vitamin D and single nucleotide polymorphisms (SNPs) in genes involved in the vitamin D cascade (VDR, CYP2R1, CYP27B1, CYP24 and DBP) could be risk factors for acute coronary syndrome (ACS).
Materials and methods
71 Patients with ACS and 443 healthy controls were genotyped for polymorphisms in genes of the vitamin D cascade. Clinical findings were correlated with serum levels of the vitamin D metabolites 1,25(OH)2D3 and 25(OH)D3.
Results
25(OH)D3 and 1,25(OH)2D3 insufficiency was more common in ACS patients than in controls (p < 0.05). After adjustments for variables and propensity score the SNPs rs4646536 and rs2296241 within CYP24 and CYP27B1 are significantly associated with ACS (p < 0.05). CYP27B1 rs4646536 genotype TT is more frequently found in ACS patients compared to healthy controls, whereas genotype TC is found at higher frequency in controls (79% vs 44% and 42% vs 5%, respectively, p < 0.01). CYP24 rs2296241 SNP genotype GG occurred less frequently in ACS vs controls (7% vs 18%), while genotype AG was found more frequently in ACS (79% vs 57%, p < 0.01).
Conclusions
Lower vitamin D levels as well as polymorphisms within the CYP27B1 and CYP24 genes seem to promote ACS. These findings may offer potential for identification of patients at increased risk for cardiovascular incidents.
Vitamin D exists in two main forms, vitamin D2 (ergocalciferol) and vitamin D3 (cholecalciferol). Vitamin D2 is predominantly obtained from eukaryote sources, like fungi and yeast, whereas vitamin D3 is produced from 7-dehydroxycholesterol upon exposure to ultraviolet B radiation
First, 7-dehydrocholesterol is converted into pre-vitamin D3 then a thermo-sensitive process isomerises pre-vitamin D3 to vitamin D3 that is delivered into the circulation where it binds to vitamin D binding protein (DBP) for systemic transport and delivery to target organs. In the liver, vitamin D3 is sequentially hydroxylated by cytochrome P450 enzymes, via 25-hydroyxlase (CYP2R1) among others, into 25-hydroxyvitamin D (25(OH)D; calcidiol or calcifediol), the major storage and circulating form of vitamin D
; 25(OH)D is frequently measured as an index of vitamin D status. Subsequently, a second hydroxyl group is added by 1α-hydroxylase (CYP27B1) to convert 25(OH)D into the active metabolite 1,25-dihydroxyvitamin D (1,25(OH)2D3; calcitriol) in the kidney.
1,25(OH)2D3 binds to the nuclear vitamin D receptor (VDR) in target organs and forms a heterodimer complex with the retinoid X receptor (RXR), recruiting other transcriptional cofactors to regulate target gene transcription by interacting with vitamin D response elements (VDRE) in gene promoter regions. A decisive step in the metabolic process is degradation of 25(OH)D and 1,25(OH)2D3 by 24-hydroxylase (CYP24A1)
There is a growing body of evidence to suggest that gene polymorphisms within the vitamin D cascade (DBP, CYP2R1, CYP27B1, CYP24 and VDR) may play an important role in the risk of developing a variety of autoimmune and non-autoimmune diseases
Plasma 25-hydroxyvitamin D and its genetic determinants in relation to incident myocardial infarction and stroke in the European prospective investigation into cancer and nutrition (EPIC)-Germany study.
, several large prospective studies have demonstrated that higher levels of 25(OH)D are associated with a lower risk of cardiovascular morbidity and mortality compared with low 25(OH)D status.
There appears to be an inverse correlation between low serum levels of 25(OH)D and atherosclerotic calcification, which is an important cardiovascular risk factor.
Coronary calcium independently predicts incident premature coronary heart disease over measured cardiovascular risk factors: mean three-year outcomes in the Prospective Army Coronary Calcium (PACC) project.
Ethnic origin and serum levels of 1alpha,25-dihydroxyvitamin D3 are independent predictors of coronary calcium mass measured by electron-beam computed tomography.
However, the mechanisms by which vitamin D and its metabolites may influence the development of cardiovascular diseases, including MI, are not fully understood yet. It has been postulated that 25(OH)D and/or 1,25(OH)2D3 could act directly via VDRs in cardiac smooth muscle cells in the vessels or muscle of the heart, or indirectly by promoting calcium absorption in the gut.
Given the controversial role of vitamin D in the pathogenesis of cardiovascular diseases, this study investigated whether low serum levels of vitamin D and polymorphisms in the vitamin D cascade (VDR, CYP2R1, CYP27B1, CYP24 and DBP) could be risk factors for acute coronary syndrome (ACS).
2. Materials and methods
2.1 Study design
This single center prospective surveillance study was conducted at the University Hospital of Frankfurt am Main between 2010 and 2012. The study protocol was approved by local ethics committee of Frankfurt University Hospital, Frankfurt am Main. All participants gave written informed consent prior to enrollment into the trial, which was conducted in accordance to the Declaration of Helsinki.
2.2 Participants
All patients who attended the Department of Cardiology (cardiology ward or intensive care unit) at the University Hospital of Frankfurt am Main were eligible for enrollment into the study. Inclusion criteria were ACS, as defined by the ESC/ACCF/AHA/WHF Third Universal Definition
and no vitamin D supplementation. There was no randomization or balanced selection for age, gender, race, region, medication or co-morbidities. A control group comprising volunteer blood donors without a history of coronary artery disease who were not receiving supplementary vitamin D was also included. Medical records, including diagnostic and therapeutic procedures, were obtained for all enrolled ACS patients.
2.3 Genotyping
Genomic DNA was obtained from whole blood within the first 6 h of hospital admittance and extracted using the salting-out procedure as previously described
and amplified using polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP) or real time polymerase chain reaction (PCR-real time) methods for detection of single nucleotide polymorphisms (SNPs) within DBP (rs4588, rs7041), CYP2R1 (rs10741657, rs12794714), CYP24 (rs927650, rs2248137, rs2296241), CYP27B1 (rs10877012, rs4646536) and VDR (rs7975232, rs731236, rs1544410, rs10735810) genes, as previously described.(Table 4)
To confirm the accuracy of the methods, random samples of the studied polymorphisms were genotyped twice, and showed a concordance of 98%.
2.4 Measurement of 25(OH)D and 1,25(OH)2D3
Plasma levels of 25(OH)D and 1,25(OH)2D3 were measured by radioimmunoassay (DiaSorin, Stillwater, Minnesota, USA and IDS, Frankfurt am Main, Germany, respectively). Levels of 25(OH)D were defined as insufficient if they were <20 ng/mL (or <50 nmol/L)
. Plasma concentrations of 1,25(OH)2D3 were considered to be in the normal range if they were 20–25 pg/mL, according to the manufacturer's instructions.
2.5 Statistics
Deviations from Hardy–Weinberg equilibrium, differences in genotype and allele distributions between groups were evaluated by Chi-squared (χ2) test (BiAS software, package 9.08; Epsilon, Weinheim, Germany). Continuous variables were compared by analysis of variance (ANOVA). Categorical comparisons were made using Chi-squared analysis. Propensity score and regression on propensity score analysis were calculated as previously reported.
Statistical significance was defined as a p-value of <0.05. Statistical analyses were performed using SPSS for Mac OS X version 21.0 and using The R Project for Statistical Computing.
3. Results
3.1 Patient characteristics
Of 514 patients screened, 71 (55 male [75%]) had ACS and were enrolled in the study (Table 1A). All participants were Caucasians. Mean patient age was 64 years for males and 68 years for females. Patients were divided into two groups: those with an acute ST elevation MI (n = 39; 29 male [74%]) and those with an acute non-ST elevation MI (n = 32; 24 male [75%]). Five patients (7%) experienced cardiac arrest and underwent successful cardiopulmonary resuscitation, 14 patients (20%) were in cardiogenic shock, and 16 patients (23%) had a history of prior MI. A total of 443 healthy controls (244 male [55%]) were included (Table 1B).
Table 1ABaseline characteristics of the ACS study group (n = 71).
All samples were in Hardy-Weinberg equilibrium (p > 0.05) for each polymorphism. Thirteen different polymorphisms for the genes encoding DBP, CYP2R1, CYP27B1, CYP24A1 and VDR were studied.
After adjustments for variables and adjustments for propensity score the SNPs rs4646536 and rs2296241 within CYP24 and CYP27B1 genes are significantly associated with ACS (p < 0.05, Table 2). In this regard in CYP27B1 rs4646536 genotype TT is more frequently found in patients with ACS compared to healthy controls, whereas genotype TC is found at higher frequency in controls compared to ACS patients (79% vs 44% and 42% vs 5%, respectively, p < 0.01), see Table 3A, Table 3B. In addition to that CYP24 rs2296241 SNP genotype GG occurred less frequently in ACS patients vs controls (7% vs 18%), while genotype AG was found more frequently in ACS (79% vs 57%, p < 0.01).
Table 2Logistic regression analysis between ACS and the polymorphisms within DBP (rs4588, rs7041), CYP2R1 (rs10741657, rs12794714), CYP24 (rs927650, rs2248137, rs2296241), CYP27B1 (rs10877012, rs4646536) and VDR (rs7975232, rs731236, rs1544410, rs10735810) genes adjusted for age, sex and 25 OH vitamin D leves and adjustments for propensity score.
Table 3B25(OH)2D serum levels were still lower in the ACS patients. Therefore the p value reflects more the already insufficiency than a true influence of the polymorphism on the vitamin D levels. Vitamin levels are given as mean values.
Real-Time PCR was analyzed using TaqMan assays in an ABI 7300 PCR (picture not shown) system under the conditions recommended by the manufacturer (Applied Biosystems).
CYP24
rs2248137
C_1915659
rs2296241
C_1915656_30
CYP27B1
rs10877012
forward: GGGAGTAAGGAGCAGAGAGGTAAA reverse, AACAGAGAGAGGGCCTGTCT FAM-labelled probe for C allele, TGTGGGAGATTCTTTTA VIC-labelled probe for A allele, CTGTGGGAGATTATTTTA
The digestion products were separated on 3% agarose gel visualized by ethidiumbromide staining.
a All enzymes used for the RFLP analyses were purchased from New England Biolabs, Inc., Beverly, MA, USA and used according manufacturer's instructions.
b Real-Time PCR was analyzed using TaqMan assays in an ABI 7300 PCR (picture not shown) system under the conditions recommended by the manufacturer (Applied Biosystems).
There were no significant differences between ACS patients and controls for any polymorphisms in genes encoding DBP, CYP2R1 or VDR genes. There was also no significant difference in these genes when patients were stratified according to gender and age (data not shown). Due to the small sample size, haplotype analysis was not performed.
3.3 Plasma levels of 25(OH)D and 1,25(OH)2D3
25(OH)D insufficiency (<20 ng/mL) was found in 81% of ACS patients compared with 28.6% of controls (Fig. 1A and B). When measured within 6 h of diagnosis, ACS patients had significantly lower 25(OH)D levels than controls (13.2 vs 21.3 ng/mL, p < 0.05).
Fig. 1Distribution of the 25(OH)D levels between patients with ACS and healthy controls.
Fig. 1A shows 25 OH vitamin D levels in ng/ml for the 71 patients with ACS and healthy controls (13.2 vs 21.3 ng/mL, p < 0.05). Fig. 1B shows the correlation of 1,25 OH vitamin D levels in pg/μl and 25 OH vitamin D levels in ng/ml to demonstrate equilibrium in vitamin D metabolism in the study population.
Low levels of 1,25(OH)2D3 (<20 pg/mL) were found in 78% of ACS patients and 14% of controls, and patients had significantly lower plasma levels compared with controls (21.5 vs 16.1 pg/mL, p < 0.05). Interestingly, patients carrying the genotype GG of the rs2248137 polymorphism within the CYP24 gene showed a higher serum level of the 1,25(OH)2D3 in comparison to the patients carrying the genotypes CC or CG (p < 0.05). There were no differences in the distribution of the other polymorphisms within the CYP24 or CYp27B1 genes and the serum levels of 1,25(OH)2D3.
When vitamin D levels were stratified by the time of year that blood samples were taken, there were no seasonal differences between patients and controls. In addition, there were no correlations between 25(OH)D levels and CD4/CD8 for chemical or clinical characteristics.
4. Discussion
The results of this study showed that patients with ACS had significantly lower vitamin D levels in the first few hours after diagnosis compared with a healthy control group. In addition, SNPs in the genes encoding for CYP24 whose mutation have been associated with infantile hypercalcemia
and CYP27B1 were also associated with ACS risk. These polymorphisms might represent a new cardiac risk factor. With our findings it could be postulated that the allele T is associated with an increased risk for ACS development, while on the other hand the genotype GG within the CYP24 rs2296241 SNP occurred less frequently in ACS patients vs controls (7% vs 18%). With genotype AG found more frequently in ACS patients (79% vs 57%, p < 0.01) and the homozygous GG less frequently detected, variant AG was also more frequent in ACS patient. Presumably, the allele G might have a protective effect regarding ACS development, while the allele A may represent increased risk.
Although it is not possible to influence or alter genetic polymorphisms, it may be that vitamin D supplementation could overcome the resulting negative effects. The findings do fit well with what is currently known about the pathophysiology of ACS. Vitamin D deficiency might lead to increased coronary calcification and to plaque rupture. Therefore vascular repair by pro-angiogenic cells after ACS may be attenuated in the presence of vitamin D deficiency.
The finding of an association between CYP24 gene polymorphisms and ACS in this study is in agreement with the results of a previous trial showing that CYP24A1 SNPs were associated with the quantity of coronary artery calcification in three independent populations.
However, the current results contradict those of a large case-control study that failed to find any significant associations between gene polymorphisms within the vitamin D cascade (vitamin D binding protein, CYP2R1, CYP27B1 and CYP24A1) and cardiovascular risk.
Plasma 25-hydroxyvitamin D and its genetic determinants in relation to incident myocardial infarction and stroke in the European prospective investigation into cancer and nutrition (EPIC)-Germany study.
Epidemiological evidence exists to support a role for vitamin D metabolites in the development of coronary artery calcification, and the risk of coronary artery disease and ACS. Their results suggested a possible role for vitamin D in the development vascular calcification.
Coronary calcium independently predicts incident premature coronary heart disease over measured cardiovascular risk factors: mean three-year outcomes in the Prospective Army Coronary Calcium (PACC) project.
These data suggest that the increased cardiovascular risk associated with vitamin D deficiency might be, at least partly, due to accelerated development of atherosclerosis. Watson et al. measured serum 1,25(OH)2D3 in asymptomatic individuals at high risk of coronary heart disease and in those with familial hypercholesterolaemia, but found inverse correlation
Serum levels of 1,25(OH)2D3 were also independently and inversely associated with coronary calcium mass in asymptomatic subjects with risk factors for coronary heart disease.
Ethnic origin and serum levels of 1alpha,25-dihydroxyvitamin D3 are independent predictors of coronary calcium mass measured by electron-beam computed tomography.
Serum concentration of calcium, 1,25 vitamin D and parathyroid hormone are not correlated with coronary calcifications. An electron beam computed tomography study.
Such discrepancies in study results with the majority reporting non-beneficial effects mean that the precise role of vitamin D in cardiovascular disease is not yet clear. Nevertheless study design, limit for vitamin D deficiency, age, ethnicity, seasonality among other factors, which may have prevented beneficial vitamin D effects, should be discussed.
Vitamin D deficiency is often seen in clinical practice, but it's implications remain to be determined. A number of studies investigating vitamin D supplementation for the primary prevention of cardiovascular disease have had negative outcomes.
Important limitations of the current study include its retrospective design and the small number of subjects. However, the results do highlight the important role of vitamin D serum levels and may be also of the vitamin D polymorphisms, at least in the first hours after the diagnosis of ACS. Suggestions for future research include a prospective study comparing vitamin D supplementation and placebo for the primary prevention of cardiovascular disease in individuals who have the gene polymorphisms identified in this study as being associated with ACS, and secondary prevention trials examining the effects of vitamin D after MI.
Funding/financial support
The study was conducted as a non-commercial trial with capital resources of the Department of Cardiology and Department of Endocrinology, Diabetes and Metabolism of the Johann Wolfgang Goethe-University, Frankfurt am Main, Germany.
Declaration of competing interest
All authors state that there is no conflict of interest in regard to this study.
Acknowledgements
English language editing assistance was provided by Nicola Ryan, independent medical writer.
Lars Palapies, German Center of Cardiovascular Research (DZHK), Site RheinMain, 60590 Frankfurt am Main, Germany, for help on statistics.
References
Holick M.F.
Binkley N.C.
Bischoff-Ferrari H.A.
et al.
Evaluation, treatment, and prevention of vitamin D deficiency: an Endocrine Society clinical practice guideline.
Plasma 25-hydroxyvitamin D and its genetic determinants in relation to incident myocardial infarction and stroke in the European prospective investigation into cancer and nutrition (EPIC)-Germany study.
Coronary calcium independently predicts incident premature coronary heart disease over measured cardiovascular risk factors: mean three-year outcomes in the Prospective Army Coronary Calcium (PACC) project.
Ethnic origin and serum levels of 1alpha,25-dihydroxyvitamin D3 are independent predictors of coronary calcium mass measured by electron-beam computed tomography.
Serum concentration of calcium, 1,25 vitamin D and parathyroid hormone are not correlated with coronary calcifications. An electron beam computed tomography study.
30154-8&id=gr1.jpg){kind=link}